Overview
Using new gene editing technology, we are able to tag and mutate genes with greater precision than ever before, creating stable cell lines endogenously expressing markers in discrete proteins associated with major cellular structures and organelles. We can then induce these cells to become any kind of cell through various differentiation steps, carrying with them through their journey these unique markers. This allows us to use live cell imaging approaches to make valuable observations about cell organization and activities as the cell divides and replicates prior to specializing toward any particular lineage, and then as it goes through terminal differentiation to a mature specialized cell type. How the cell repurposes an essentially finite set of tools into an array of specialized systems to serve the unique purposes of each cell type then begins to emerge. Using specialized 3D analysis approaches in conjunction with modeling and machine learning approaches, we can integrate the information we are generating into an interactive 3D animation based on data from studies in real cells. These lines and the analysis and modeling approaches will be available to the community as part of our open access policy.
Standard operating procedure downloads
Gene editing, molecular and cellular biology
Cell reprogramming
At the Allen Institute for Cell Science, we are not reprogramming our own iPSCs. For this first set of gene edited cell lines we have used the WTC parental line which was generously provided by Bruce Conklin at the Gladstone Institutes. This line was derived episomally from a healthy donor and has been fully sequenced, has a normal karyotype, differentiates into multiple cell types, and is amenable to gene editing. We are also able to make it available to the research community and sequence its genome: properties shared by few other lines of which we know.
At the Allen Institute for Cell Science, we are not reprogramming our own iPSCs. For this first set of gene edited cell lines we have used the WTC parental line which was generously provided by Bruce Conklin at the Gladstone Institutes. This line was derived episomally from a healthy donor and has been fully sequenced, has a normal karyotype, differentiates into multiple cell types, and is amenable to gene editing. We are also able to make it available to the research community and sequence its genome: properties shared by few other lines of which we know.
Cell culture
WTC hiPSCs are cultured in a feeder-free system on tissue culture dishes or plates coated with GFR Matrigel (Corning) diluted 1:30 in cold DMEM/F12 (Gibco). Undifferentiated cells are maintained with mTeSR1 media (STEMCELL Technologies) supplemented with 1% (v/v) Penicillin-streptomycin (P/S) (Gibco). Cells are not allowed to reach confluency greater than 85% and are passaged every 3-4 days by dissociation into single-cell suspension using StemPro® Accutase® (Gibco). When in single cell suspension, cells are counted using a Vi-CELL® Series Cell Viability Analyzer (Beckman Coulter). After passaging, cells are re-plated in mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor (Stemolecule Y-27632, Stemgent) for 24 h. Media is replenished with fresh mTeSR1 media supplemented with 1% P/S daily. Cells are maintained at 37˚C and 5% CO2. Our Standard Operating Procedure for WTC culture is available here.
WTC hiPSCs are cultured in a feeder-free system on tissue culture dishes or plates coated with GFR Matrigel (Corning) diluted 1:30 in cold DMEM/F12 (Gibco). Undifferentiated cells are maintained with mTeSR1 media (STEMCELL Technologies) supplemented with 1% (v/v) Penicillin-streptomycin (P/S) (Gibco). Cells are not allowed to reach confluency greater than 85% and are passaged every 3-4 days by dissociation into single-cell suspension using StemPro® Accutase® (Gibco). When in single cell suspension, cells are counted using a Vi-CELL® Series Cell Viability Analyzer (Beckman Coulter). After passaging, cells are re-plated in mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor (Stemolecule Y-27632, Stemgent) for 24 h. Media is replenished with fresh mTeSR1 media supplemented with 1% P/S daily. Cells are maintained at 37˚C and 5% CO2. Our Standard Operating Procedure for WTC culture is available here.
Donor plasmids, crRNAs & Cas9 protein
Donor plasmids are designed uniquely for each target locus, with each following a similar design strategy. Homology arms 5′ and 3′ of the desired insertion site are each 1 kb in length and designed from the GRCh38 reference genome, corrected for known WTC SNPs. Linkers for each protein are unique and are used to join the terminus of the protein with the mEGFP-encoding sequence (inserted 5′ of mEGFP for C-terminal tags and 3′ of mEGFP for N-terminal tags). To prevent crRNAs from targeting donor plasmid sequence, certain mutations are introduced to disrupt crRNA binding; when possible, these changes do not affect the amino acid sequence. All plasmids have been deposited at https://www.addgene.org/The_Allen_Institute_for_Cell_Science/ and are initially created either by In-Fusion (Clontech) assembly of gBlock pieces (IDT) into a pUC19 backbone, or are synthesized and cloned into a pUC57 backbone by Genewiz. Plasmid DNA for transfection is prepared using endotoxin-free purification kits (NucleoBond® Xtra Maxi EF, Clontech). Custom synthetic crRNAs and their corresponding tracrRNAs are ordered from either IDT or Dharmacon. Recombinant wild type S. pyogenes Cas9 protein is purchased from the UC Berkeley QB3 Macrolab. The majority of our tagging experiments use the mEGFP (K206A) sequence. Thus far PXN is the only one that used EGFP instead. Detailed information on editing design can be found in the online Cell Catalog.
Donor plasmids are designed uniquely for each target locus, with each following a similar design strategy. Homology arms 5′ and 3′ of the desired insertion site are each 1 kb in length and designed from the GRCh38 reference genome, corrected for known WTC SNPs. Linkers for each protein are unique and are used to join the terminus of the protein with the mEGFP-encoding sequence (inserted 5′ of mEGFP for C-terminal tags and 3′ of mEGFP for N-terminal tags). To prevent crRNAs from targeting donor plasmid sequence, certain mutations are introduced to disrupt crRNA binding; when possible, these changes do not affect the amino acid sequence. All plasmids have been deposited at https://www.addgene.org/The_Allen_Institute_for_Cell_Science/ and are initially created either by In-Fusion (Clontech) assembly of gBlock pieces (IDT) into a pUC19 backbone, or are synthesized and cloned into a pUC57 backbone by Genewiz. Plasmid DNA for transfection is prepared using endotoxin-free purification kits (NucleoBond® Xtra Maxi EF, Clontech). Custom synthetic crRNAs and their corresponding tracrRNAs are ordered from either IDT or Dharmacon. Recombinant wild type S. pyogenes Cas9 protein is purchased from the UC Berkeley QB3 Macrolab. The majority of our tagging experiments use the mEGFP (K206A) sequence. Thus far PXN is the only one that used EGFP instead. Detailed information on editing design can be found in the online Cell Catalog.
Transfection and enrichment by fluorescence-activated cell sorting (FACS)
Cells are dissociated into single-cell suspension (see Cell culture above). Transfections are performed using the Neon transfection system (Life Technologies). We evaluated various delivery methods including CRISPRMAX (Thermo Fisher), GeneJuice (EMD Millipore), Amaxa (Lonza) and Neon (Thermo Fisher) and concluded that Neon electroporation resulted in favorable co-introduction of protein, RNA, and plasmid into hiPSCs as measured by transfection of a control reporter plasmid and T7 assays as a readout for Cas9 activity. Cas9:crRNA:tracrRNA pre-complexed 1:1:1 and co-transfected with 2 µg of donor plasmid optimally balanced editing efficiency with cell survival after transfection (data not shown) and thus this platform is used for all editing experiments. Our Standard Operating Procedure for RNP transfection is available here.
Cells (8x105) are re-suspended in 100 µL Neon Buffer R with 2 µg donor plasmid, 2 µg Cas9 protein, and duplexed crRNA:tracrRNA in a 1:1 molar ratio to Cas9, pre-complexed for 10 minutes at room temperature, then electroporated with one pulse at 1300 V for 30 ms, and plated onto Matrigel-coated 6-well dishes with mTeSR1 media supplemented with 1% P/S and 10 µM ROCK inhibitor. Transfected cells are cultured as described above for 3-4 days until the transfected culture had recovered to ~70% confluence. Cells are harvested for FACS using Accutase, as described above. The cell suspension (0.5 – 1.0 x 106 cells/mL in mTeSR1 + ROCK inhibitor) is filtered through a 35 µM mesh filter into polystyrene round bottomed tubes. Cells are sorted using a FACSAriaIII Fusion (BD Bioscience) with a 130 µM nozzle and FACSDiva software (BD Bioscience). Forward scatter and side scatter (height versus width) are used to exclude doublets and the GFP-positive gate is set using live, untransfected WTC cells such that <0.1% of untransfected cells fall within the gate. Sorted populations are plated into Matrigel-coated 96-well plates (<2 x 103 cells recovered) or 24-well plates (<104 cells recovered) for expansion of the whole enriched population before clone picking. In some cases, (e.g. PXN), co-isolation of presumptively unedited cells is tolerated due to the weak GFP fluorescence intensity of tagged protein. To determine %HDR, data were analyzed using FlowJo V.10.2.
Cells are dissociated into single-cell suspension (see Cell culture above). Transfections are performed using the Neon transfection system (Life Technologies). We evaluated various delivery methods including CRISPRMAX (Thermo Fisher), GeneJuice (EMD Millipore), Amaxa (Lonza) and Neon (Thermo Fisher) and concluded that Neon electroporation resulted in favorable co-introduction of protein, RNA, and plasmid into hiPSCs as measured by transfection of a control reporter plasmid and T7 assays as a readout for Cas9 activity. Cas9:crRNA:tracrRNA pre-complexed 1:1:1 and co-transfected with 2 µg of donor plasmid optimally balanced editing efficiency with cell survival after transfection (data not shown) and thus this platform is used for all editing experiments. Our Standard Operating Procedure for RNP transfection is available here.
Cells (8x105) are re-suspended in 100 µL Neon Buffer R with 2 µg donor plasmid, 2 µg Cas9 protein, and duplexed crRNA:tracrRNA in a 1:1 molar ratio to Cas9, pre-complexed for 10 minutes at room temperature, then electroporated with one pulse at 1300 V for 30 ms, and plated onto Matrigel-coated 6-well dishes with mTeSR1 media supplemented with 1% P/S and 10 µM ROCK inhibitor. Transfected cells are cultured as described above for 3-4 days until the transfected culture had recovered to ~70% confluence. Cells are harvested for FACS using Accutase, as described above. The cell suspension (0.5 – 1.0 x 106 cells/mL in mTeSR1 + ROCK inhibitor) is filtered through a 35 µM mesh filter into polystyrene round bottomed tubes. Cells are sorted using a FACSAriaIII Fusion (BD Bioscience) with a 130 µM nozzle and FACSDiva software (BD Bioscience). Forward scatter and side scatter (height versus width) are used to exclude doublets and the GFP-positive gate is set using live, untransfected WTC cells such that <0.1% of untransfected cells fall within the gate. Sorted populations are plated into Matrigel-coated 96-well plates (<2 x 103 cells recovered) or 24-well plates (<104 cells recovered) for expansion of the whole enriched population before clone picking. In some cases, (e.g. PXN), co-isolation of presumptively unedited cells is tolerated due to the weak GFP fluorescence intensity of tagged protein. To determine %HDR, data were analyzed using FlowJo V.10.2.
Cell plating for imaging
Cells were plated on glass bottom multi-well plates (P96-1.5H-N or P24-1.5H-N, Cellvis) coated with phenol red-free GFR Matrigel (356231, Corning) diluted 1:30 in phenol red-free DMEM/F12 (11039021, Gibco). Cells were seeded at a density of 2.5x103 in 96-well plates and 12.5x103 to 18x103 on 24-well plates and fixed or imaged 3-4 days later. Our Standard Operating Procedure for cell plating for imaging is available here.
Live cell imaging
Cells were maintained with phenol red free mTeSR1 media (custom order, STEMCELL Technologies) one day prior to live cell imaging. Cells were imaged on a Carl Zeiss spinning disk microscope with a Carl Zeiss 20x/0.8 NA plan APOCHROMAT or 100x/1.25 W C-APOCHROMAT Korr UV Vis IR objective, a CSU-X1 Yokogawa spinning disk head, and Hammamatsu Orca Flash 4.0 camera. Microscopes were outfitted with a humidified environmental chamber to maintain cells at 37°C with 5% CO2 during imaging.
Cells were plated on glass bottom multi-well plates (P96-1.5H-N or P24-1.5H-N, Cellvis) coated with phenol red-free GFR Matrigel (356231, Corning) diluted 1:30 in phenol red-free DMEM/F12 (11039021, Gibco). Cells were seeded at a density of 2.5x103 in 96-well plates and 12.5x103 to 18x103 on 24-well plates and fixed or imaged 3-4 days later. Our Standard Operating Procedure for cell plating for imaging is available here.
Live cell imaging
Cells were maintained with phenol red free mTeSR1 media (custom order, STEMCELL Technologies) one day prior to live cell imaging. Cells were imaged on a Carl Zeiss spinning disk microscope with a Carl Zeiss 20x/0.8 NA plan APOCHROMAT or 100x/1.25 W C-APOCHROMAT Korr UV Vis IR objective, a CSU-X1 Yokogawa spinning disk head, and Hammamatsu Orca Flash 4.0 camera. Microscopes were outfitted with a humidified environmental chamber to maintain cells at 37°C with 5% CO2 during imaging.
Clonal cell line generation
Cells from the FACS-enriched population are seeded at a density of 104 cells in a 10 cm Matrigel-coated tissue culture plate. After 5-7 days clones are manually picked with a pipette and transferred into individual wells of 96-well Matrigel-coated tissue culture plates and expanded clonally. We find >90% of these clones survive colony picking. After 3-4 days colonies are dispersed with Accutase and transferred into a fresh 96-well plate. After recovery, the plate is divided into plates for ongoing culture or freezing and gDNA isolation. To cryopreserve clones in 96-well format, when cells are 60-85% confluent, they are dissociated and pelleted in 96-well V-bottom plates. Cells are then re-suspended in 60 µL mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor. Two sister plates are frozen using 30 µL cell suspension per plate, added to 170 µL CryoStor® CS10 (STEMCELL Technologies) in non-Matrigel coated 96-well tissue culture plates. Plates are sealed with Parafilm and introduced to the -80˚C freezer in a room temperature Styrofoam box. Plates are stored long term at -80˚C for up to 8 weeks before thawing.
Cells from the FACS-enriched population are seeded at a density of 104 cells in a 10 cm Matrigel-coated tissue culture plate. After 5-7 days clones are manually picked with a pipette and transferred into individual wells of 96-well Matrigel-coated tissue culture plates and expanded clonally. We find >90% of these clones survive colony picking. After 3-4 days colonies are dispersed with Accutase and transferred into a fresh 96-well plate. After recovery, the plate is divided into plates for ongoing culture or freezing and gDNA isolation. To cryopreserve clones in 96-well format, when cells are 60-85% confluent, they are dissociated and pelleted in 96-well V-bottom plates. Cells are then re-suspended in 60 µL mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor. Two sister plates are frozen using 30 µL cell suspension per plate, added to 170 µL CryoStor® CS10 (STEMCELL Technologies) in non-Matrigel coated 96-well tissue culture plates. Plates are sealed with Parafilm and introduced to the -80˚C freezer in a room temperature Styrofoam box. Plates are stored long term at -80˚C for up to 8 weeks before thawing.
Genetic screening with ddPCR
During clone expansion, a sample of cells is pelleted for total gDNA extraction using the PureLink Pro 96 Genomic DNA Purification Kit (Life Technologies). ddPCR is performed using the Bio-Rad QX200 Droplet Reader, Droplet Generator, and QuantaSoft software. The reference assay for the 2-copy, autosomal gene RPP30 is purchased from Bio-Rad. The assay for mEGFP detection is as follows: primers (5′-GCCGACAAGCAGAAGAACG-3′, 5′-GGGTGTTCTGCTGGTAGTGG-3′) probe (/56-FAM/AGATCCGCC/ZEN/ACAACATCGAGG/3IABkFQ/). The assay for AMP is as follows: primers (5′- TTTCCGTGTCGCCCTTATTCC -3′, 5′- ATGTAACCCACTCGTGCACCC -3′) probe (/5HEX/TGGGTGAGC/ZEN/AAAAACAGGAAGGC/3IABkFQ/). The reported final copy number of mEGFP per genome is calculated as the ratio of [(copies/µLmEGFP)-(copies/µLnonintegraedAMP)]/(copies/µLRPP30), where a ratio of 0.5 ~ 1 copy per genome and a ratio of 1 ~ 2 copies/genome. The AMP sequence is only used to normalize mEGFP signal when integration into the genome is ruled out during primary screening. For primary screening [(copies/µLmEGFP)/(copies/µLRPP30) is plotted against [(copies/µLAMP)/(copies/µLRPP30) in order to identify cohorts of clones for ongoing analysis. Our Standard Operating Procedure for ddPCR is available here.
During clone expansion, a sample of cells is pelleted for total gDNA extraction using the PureLink Pro 96 Genomic DNA Purification Kit (Life Technologies). ddPCR is performed using the Bio-Rad QX200 Droplet Reader, Droplet Generator, and QuantaSoft software. The reference assay for the 2-copy, autosomal gene RPP30 is purchased from Bio-Rad. The assay for mEGFP detection is as follows: primers (5′-GCCGACAAGCAGAAGAACG-3′, 5′-GGGTGTTCTGCTGGTAGTGG-3′) probe (/56-FAM/AGATCCGCC/ZEN/ACAACATCGAGG/3IABkFQ/). The assay for AMP is as follows: primers (5′- TTTCCGTGTCGCCCTTATTCC -3′, 5′- ATGTAACCCACTCGTGCACCC -3′) probe (/5HEX/TGGGTGAGC/ZEN/AAAAACAGGAAGGC/3IABkFQ/). The reported final copy number of mEGFP per genome is calculated as the ratio of [(copies/µLmEGFP)-(copies/µLnonintegraedAMP)]/(copies/µLRPP30), where a ratio of 0.5 ~ 1 copy per genome and a ratio of 1 ~ 2 copies/genome. The AMP sequence is only used to normalize mEGFP signal when integration into the genome is ruled out during primary screening. For primary screening [(copies/µLmEGFP)/(copies/µLRPP30) is plotted against [(copies/µLAMP)/(copies/µLRPP30) in order to identify cohorts of clones for ongoing analysis. Our Standard Operating Procedure for ddPCR is available here.
Genetic screening with tiled junctional PCR
PCR was used to amplify the tagged allele in two tiled reactions spanning the left and right homology arms, the mEGFP and linker sequence, and portions of the distal genomic region 5’ of the left homology arm and 3’ of the right homology arm using PrimeStar® (Clontech) PCR reagents and gene-specific primers. Both tiled junctional PCR products were Sanger sequenced bi-directionally with PCR primers when their size was validated by gel electrophoresis and/or fragment analysis (Advanced Analytics Fragment Analyzer).
Screening for clones with wild type untagged allele sequences
PCR is also used to amplify the untagged allele using gene-specific primers. These primers do not selectively amplify the unmodified locus, as is the case for tiled junctional PCR amplification of the tagged allele, but rather amplified both untagged and tagged alleles. Tracking of insertions and deletions (INDELs) by decomposition (TIDE) analysis is performed manually on the amplification reaction after bidirectional Sanger sequencing in order to determine the sequence of the untagged allele. For all final clones with wild type untagged alleles, the PCR product corresponding to the untagged allele is gel isolated and sequenced to confirm the initial result from TIDE analysis.
Off-target PCR screening
Cas-OFFinder is used to identify potential off-targets (NRG PAMs with up to 3 mismatches and 1 DNA or RNA bulge) in GRCh38 genome build. Cas-OFFinder output is further filtered to identify the most problematic off-targets with the fewest number of flaws (flaw = mismatch or bulge). Problematic off-targets are defined as off-targets with up to one flaw in the seed region (10 nts at 3’ end) and up to 2 flaws in the non-seed region (10 nts at 5’ end) with an NGG or NAG PAM. 8-10 of these off-targets are selected for sequencing with the goal of checking ~4 off-targets that fell close to exons (within 50bp) or within exons (exon feature in GRCh38 NCBI annotation 107) and ~4 off-targets that are closest in sequence to on-target crRNA. Approximately 300bp of sequence flanking each off-target is amplified by PCR and Sanger sequenced.
Pluripotency testing by flow cytometry
Cells are dissociated with Accutase as described above, fixed with CytoFix Fixation Buffer™ for 30 minutes at 4°C, and frozen in KnockOut™ Serum Replacement (Gibco) with 10% DMSO. Cells are washed with 2% BSA in DPBS and half of the cells are stained with anti-TRA-1-60 Brilliant Violet™ 510, anti-SSEA-3 AlexaFluor® 647, and anti-SSEA-1 Brilliant Violet™ 421. The other half of the cells are permeabilized with 0.1% Triton-X100 and 2% BSA in DPBS and stained with anti-Nanog AlexaFluor® 647, anti-Sox2 V450, and anti-Oct-3/4 Brilliant Violet™ 510. Cells are acquired on a FACSAriaIII Fusion equipped with 405, 488, 561, and 637 nm lasers and analyzed using FlowJo V.10.2. Doublets are excluded using forward scatter and side scatter, then marker-specific gates are set according to corresponding fluorescence-minus-one (FMO) controls to obtain the percent positive for each marker. Forward scatter and side scatter is used to distinguish cells and debris for analysis.
Karyotype analysis
Karyotype analysis is performed by Diagnostic Cytogenetics Inc. At a minimum 20 metaphase cells are analyzed per clone.
PCR was used to amplify the tagged allele in two tiled reactions spanning the left and right homology arms, the mEGFP and linker sequence, and portions of the distal genomic region 5’ of the left homology arm and 3’ of the right homology arm using PrimeStar® (Clontech) PCR reagents and gene-specific primers. Both tiled junctional PCR products were Sanger sequenced bi-directionally with PCR primers when their size was validated by gel electrophoresis and/or fragment analysis (Advanced Analytics Fragment Analyzer).
Screening for clones with wild type untagged allele sequences
PCR is also used to amplify the untagged allele using gene-specific primers. These primers do not selectively amplify the unmodified locus, as is the case for tiled junctional PCR amplification of the tagged allele, but rather amplified both untagged and tagged alleles. Tracking of insertions and deletions (INDELs) by decomposition (TIDE) analysis is performed manually on the amplification reaction after bidirectional Sanger sequencing in order to determine the sequence of the untagged allele. For all final clones with wild type untagged alleles, the PCR product corresponding to the untagged allele is gel isolated and sequenced to confirm the initial result from TIDE analysis.
Off-target PCR screening
Cas-OFFinder is used to identify potential off-targets (NRG PAMs with up to 3 mismatches and 1 DNA or RNA bulge) in GRCh38 genome build. Cas-OFFinder output is further filtered to identify the most problematic off-targets with the fewest number of flaws (flaw = mismatch or bulge). Problematic off-targets are defined as off-targets with up to one flaw in the seed region (10 nts at 3’ end) and up to 2 flaws in the non-seed region (10 nts at 5’ end) with an NGG or NAG PAM. 8-10 of these off-targets are selected for sequencing with the goal of checking ~4 off-targets that fell close to exons (within 50bp) or within exons (exon feature in GRCh38 NCBI annotation 107) and ~4 off-targets that are closest in sequence to on-target crRNA. Approximately 300bp of sequence flanking each off-target is amplified by PCR and Sanger sequenced.
Pluripotency testing by flow cytometry
Cells are dissociated with Accutase as described above, fixed with CytoFix Fixation Buffer™ for 30 minutes at 4°C, and frozen in KnockOut™ Serum Replacement (Gibco) with 10% DMSO. Cells are washed with 2% BSA in DPBS and half of the cells are stained with anti-TRA-1-60 Brilliant Violet™ 510, anti-SSEA-3 AlexaFluor® 647, and anti-SSEA-1 Brilliant Violet™ 421. The other half of the cells are permeabilized with 0.1% Triton-X100 and 2% BSA in DPBS and stained with anti-Nanog AlexaFluor® 647, anti-Sox2 V450, and anti-Oct-3/4 Brilliant Violet™ 510. Cells are acquired on a FACSAriaIII Fusion equipped with 405, 488, 561, and 637 nm lasers and analyzed using FlowJo V.10.2. Doublets are excluded using forward scatter and side scatter, then marker-specific gates are set according to corresponding fluorescence-minus-one (FMO) controls to obtain the percent positive for each marker. Forward scatter and side scatter is used to distinguish cells and debris for analysis.
Karyotype analysis
Karyotype analysis is performed by Diagnostic Cytogenetics Inc. At a minimum 20 metaphase cells are analyzed per clone.
RNA-Seq analysis
Two independent clonal populations are sequenced from each cell line. After dissociation of cell cultures with Accutase, 2-3 x 106 cells are pelleted, washed once with DPBS and either re-suspended in 350 µL of Qiagen RLT plus lysis buffer or left as cell pellets, then flash frozen in liquid nitrogen before storage at -80˚C. The variation in cell pellet treatment is based on the sequencing service provider’s sample submission guidelines. 101bp paired end libraries are prepared using an Illumina TruSeq Total RNA kit. Libraries are sequenced on an Illumina HiSeq 2500 at a depth of 30-50 million read pairs. Reads are mapped to human genome build GRCh38 and NCBI annotations 107 using STAR aligner. Read counts are extracted from each alignment using htseq, and differentially expressed genes relative to the reference WTC line are identified using DESeq2. Size factors and dispersions are estimated from all samples and differentially expressed genes are identified using pairwise Wald tests in DESeq2 (Benjamini-Hochberg adjusted p-value < 0.05 w/ abs (log2 fold change) > 1).
Two independent clonal populations are sequenced from each cell line. After dissociation of cell cultures with Accutase, 2-3 x 106 cells are pelleted, washed once with DPBS and either re-suspended in 350 µL of Qiagen RLT plus lysis buffer or left as cell pellets, then flash frozen in liquid nitrogen before storage at -80˚C. The variation in cell pellet treatment is based on the sequencing service provider’s sample submission guidelines. 101bp paired end libraries are prepared using an Illumina TruSeq Total RNA kit. Libraries are sequenced on an Illumina HiSeq 2500 at a depth of 30-50 million read pairs. Reads are mapped to human genome build GRCh38 and NCBI annotations 107 using STAR aligner. Read counts are extracted from each alignment using htseq, and differentially expressed genes relative to the reference WTC line are identified using DESeq2. Size factors and dispersions are estimated from all samples and differentially expressed genes are identified using pairwise Wald tests in DESeq2 (Benjamini-Hochberg adjusted p-value < 0.05 w/ abs (log2 fold change) > 1).
Immunocytochemistry & fixed cell imaging
All cell lines except for TUBA1B were fixed and permeabilized in 24- or 96-well plates with a solution of 4% paraformaldehyde (15710 , Electron Microscopy Sciences Hatfield, PA) and 0.5% Triton X-100 (TX1568-3 ,EMD Millipore) for 10-15 min. TUBA1B cells were fixed in -20°C methanol for 5 min. Following fixation and permeabilization, all cells were blocked with 1% or 5% BSA (15260-037, ThermoFisher Scientific) in 1x PermWash Buffer (51-2091K7, BD Biosciences), incubated in primary antibody overnight at 4°C, followed by incubation in AlexaFluor®-conjugated secondary antibodies (see Table 1 below) and DAPI (1x NucBlue Fixed Cell Stain, R37606, ThermoFisher Scientific) for 2 hr at room temperature. In the case of ACTB, cells were stained with Rhodamine Phalloidin (R415, ThermoFisher Scientific) at 1:1000. SlowFade Gold (S36936, ThermoFisher Scientific) mounting media was added to the cells after a final washing step and cells were stored at -20°C until imaged as described in the above section. All fixed cells except for DSP and SEC61B were imaged on a 3i system with a Zeiss 100x/1.46 NA α-plan APOCHROMAT oil objective, CSU-W1 Yokogawa spinning disk head and Hammamatsu Orca Flash 4.0 camera. DSP cells (and corresponding controls) were imaged on a Zeiss laser scanning (LSM) 880 confocal microscope with a Zeiss C-APOCHROMAT 40x/1.2 W Korr FCS M27 objective. SEC61-ß cells were imaged with a Zeiss 100x/1.25 W C APOCHROMAT Korr UV Vis IR objective, a CSU-W1 Yokogawa spinning disk head, and Hammamatsu Orca Flash 4.0 camera.
All cell lines except for TUBA1B were fixed and permeabilized in 24- or 96-well plates with a solution of 4% paraformaldehyde (15710 , Electron Microscopy Sciences Hatfield, PA) and 0.5% Triton X-100 (TX1568-3 ,EMD Millipore) for 10-15 min. TUBA1B cells were fixed in -20°C methanol for 5 min. Following fixation and permeabilization, all cells were blocked with 1% or 5% BSA (15260-037, ThermoFisher Scientific) in 1x PermWash Buffer (51-2091K7, BD Biosciences), incubated in primary antibody overnight at 4°C, followed by incubation in AlexaFluor®-conjugated secondary antibodies (see Table 1 below) and DAPI (1x NucBlue Fixed Cell Stain, R37606, ThermoFisher Scientific) for 2 hr at room temperature. In the case of ACTB, cells were stained with Rhodamine Phalloidin (R415, ThermoFisher Scientific) at 1:1000. SlowFade Gold (S36936, ThermoFisher Scientific) mounting media was added to the cells after a final washing step and cells were stored at -20°C until imaged as described in the above section. All fixed cells except for DSP and SEC61B were imaged on a 3i system with a Zeiss 100x/1.46 NA α-plan APOCHROMAT oil objective, CSU-W1 Yokogawa spinning disk head and Hammamatsu Orca Flash 4.0 camera. DSP cells (and corresponding controls) were imaged on a Zeiss laser scanning (LSM) 880 confocal microscope with a Zeiss C-APOCHROMAT 40x/1.2 W Korr FCS M27 objective. SEC61-ß cells were imaged with a Zeiss 100x/1.25 W C APOCHROMAT Korr UV Vis IR objective, a CSU-W1 Yokogawa spinning disk head, and Hammamatsu Orca Flash 4.0 camera.
Table 1: Primary antibodies
Antibody |
Type |
Source |
Application |
Secondary antibody used |
α-tubulin |
mouse monoclonal, clone DM1A |
ThermoFisher #62204 |
WB: 1:10,000 IF: 1:250 |
goat anti-mouse goat anti-mouse |
ß-actin |
mouse monoclonal, clone GT5512 |
GeneTex #GTX629630 |
WB: 1:10,000 |
goat anti-mouse |
desmoplakin |
rabbit polyclonal NW6 rabbit polyclonal 1G4 |
Kathleen Green, Northwestern University |
WB, 1:1,000 IF: 1:20 |
goat anti-rabbit goat anti-rabbit |
fibrillarin |
rabbit polyclonal |
Abcam #ab5821 |
WB: 1:800 IF: 1:100 |
goat anti-rabbit goat anti-rabbit |
lamin B1 |
rabbit polyclonal |
Abcam #ab16048 |
WB: 1:2,000 IF: 1:500 |
goat anti-rabbit goat anti-rabbit |
myosin IIB |
rabbit polyclonal |
Cell Signaling Technology #3404 |
WB, 1:1,000 IF: 1:200 |
goat anti-rabbit goat anti-rabbit |
paxillin |
mouse monocolonal, clone 349 |
BD Biosciences #610051 |
WB: 1:10,000 IF: 1:750 |
goat anti-mouse goat anti-mouse |
Sec61-ß |
rabbit polyclonal rabbit polyclonal |
•Abcam #ab15576 •Sigma Aldrich #HPA049407 |
WB: 1:10,000 IF 1:250 IF: 1:25 |
goat anti-rabbit goat anti-rabbit |
ZO1 |
rabbit polyclonal |
ThermoFisher #617300 |
WB: 1:500 IF: 1:50 |
goat anti-rabbit |
Tom20 |
mouse monoclonal clone F10 |
Santa Cruz Biotechnologies #sc17764 |
WB: 1:250 IF: 1:100 |
goat anti-mouse goat anti-mouse |
ß-actin (loading control) |
mouse monoclonal, clone BA3R |
ThermoFisher #MA515739 |
WB: 1:10,000 |
goat anti-mouse |
α-actinin (loading control) |
mouse monoclonal, clone 0.T.02 |
ThermoFisher #MA191860 |
WB: 1:2,000 |
goat anti-mouse |
GFP |
mouse monoclonal mix, clones 7.1 and 13.1 |
Sigma Aldrich #11814460001 |
WB: 1:250 |
goat anti-mouse |
Table 2. Secondary antibodies
Antibody |
Type |
Source |
Application |
goat anti-mouse IgG (H+L), Alexa Fluor® 647 conjugate |
goat polyclonal |
ThermoFisher #A21236 |
WB: 1:10,000 IF: 1:500 |
goat anti-rabbit IgG (H+L), Alexa Fluor® 647 conjugate |
goat polyclonal |
ThermoFisher #A21245 |
WB: 1:10,000 IF: 1:500 |
Western blotting
Whole-cell lysate was extracted from cell lines using M-PER buffer (78501, ThermoFisher Scientific) supplemented with 1X Halt protease and phosphatase inhibitors (78442, ThermoFisher), 0.16 M MgCl2 and 100 U Pierce universal nuclease (88700, ThermoFisher Scientific) on ice for 30 min or urea sample buffer (USB: 8M urea, 1% SDS, 10% glycerol, 0.06 M Tris pH 6.8, 0.001% pyronin Y). M-PER-based cell lysates were boiled for 5 minutes, then diluted with 1:1 Bolt LDS sample buffer (B008, ThermoFisher Scientific), heated at 70°C for 10 min and stored at -20°C. Prior to gel electrophoresis, M-PER-based samples were diluted to a final concentration with 1X Bolt LDS sample buffer, supplemented with 1X Bolt sample reducing agent (B0009, Thermo Fisher Scientific) and heated to 70°C for 10 min. USB-based cell lysates were triturated with a syringe and a 27g needle and stored at -20°C. For electrophoresis, USB-based samples were supplemented with 5% ß-mercaptoethanol (190242, ThermoFisher Scientific). Lysates were separated on 4-12% Bolt Bis-Tris Plus gels (NM04122BOX, ,ThermoFisher Scientific), 1X MOPS SDS running buffer (B0001, ThermoFisher Scientific) supplemented with Bolt antioxidant (BT005, ThermoFisher Scientific) or NuPAGE Novex 3-8% Tris-Acetate gels (EA0378BOX, ThermoFisher Scientific), 1x Tris acetate SDS running buffer (LA004, ThermoFisher Scientific), supplemented with Bolt antioxidant and transferred onto 0.45 µm nitrocellulose membranes (LC2001, ThermoFisher Scientific) using the XCell SureLock Mini-Cell System (ThermoFisher Scientific). Untagged and GFP-tagged proteins were detected using protein-specific and GFP-specific antibodies in PBS-T with 5% milk overnight at 4°C (see Table 1 for details). ß-actin was used as the loading control for PXN, SEC61B, TUBA1B, TJP1, and MYH10, while α-tubulin was used for LMNB1, FBL, ACTB and DSP, and α-actinin for TOMM20 (see Table 1 for details). Goat polyclonal anti-mouse AlexaFluorR 647-conjugated secondary antibody or goat polyclonal anti-rabbit AlexaFluorR 647-conjugated antibody) were used as secondary antibodies as described in Table 2 above. Blots were imaged at different exposure times using the ChemiDoc MP system (Bio-Rad Laboratories) and appropriate exposure times were used for semi-quantitative analysis of protein levels.
Whole-cell lysate was extracted from cell lines using M-PER buffer (78501, ThermoFisher Scientific) supplemented with 1X Halt protease and phosphatase inhibitors (78442, ThermoFisher), 0.16 M MgCl2 and 100 U Pierce universal nuclease (88700, ThermoFisher Scientific) on ice for 30 min or urea sample buffer (USB: 8M urea, 1% SDS, 10% glycerol, 0.06 M Tris pH 6.8, 0.001% pyronin Y). M-PER-based cell lysates were boiled for 5 minutes, then diluted with 1:1 Bolt LDS sample buffer (B008, ThermoFisher Scientific), heated at 70°C for 10 min and stored at -20°C. Prior to gel electrophoresis, M-PER-based samples were diluted to a final concentration with 1X Bolt LDS sample buffer, supplemented with 1X Bolt sample reducing agent (B0009, Thermo Fisher Scientific) and heated to 70°C for 10 min. USB-based cell lysates were triturated with a syringe and a 27g needle and stored at -20°C. For electrophoresis, USB-based samples were supplemented with 5% ß-mercaptoethanol (190242, ThermoFisher Scientific). Lysates were separated on 4-12% Bolt Bis-Tris Plus gels (NM04122BOX, ,ThermoFisher Scientific), 1X MOPS SDS running buffer (B0001, ThermoFisher Scientific) supplemented with Bolt antioxidant (BT005, ThermoFisher Scientific) or NuPAGE Novex 3-8% Tris-Acetate gels (EA0378BOX, ThermoFisher Scientific), 1x Tris acetate SDS running buffer (LA004, ThermoFisher Scientific), supplemented with Bolt antioxidant and transferred onto 0.45 µm nitrocellulose membranes (LC2001, ThermoFisher Scientific) using the XCell SureLock Mini-Cell System (ThermoFisher Scientific). Untagged and GFP-tagged proteins were detected using protein-specific and GFP-specific antibodies in PBS-T with 5% milk overnight at 4°C (see Table 1 for details). ß-actin was used as the loading control for PXN, SEC61B, TUBA1B, TJP1, and MYH10, while α-tubulin was used for LMNB1, FBL, ACTB and DSP, and α-actinin for TOMM20 (see Table 1 for details). Goat polyclonal anti-mouse AlexaFluorR 647-conjugated secondary antibody or goat polyclonal anti-rabbit AlexaFluorR 647-conjugated antibody) were used as secondary antibodies as described in Table 2 above. Blots were imaged at different exposure times using the ChemiDoc MP system (Bio-Rad Laboratories) and appropriate exposure times were used for semi-quantitative analysis of protein levels.
Transient transfection for live cell imaging
The constructs pmEGFP-a-tubulin-C1 (gift from Daniel Gerlich, addgene plasmid # 21039), 1136-Desmoplakin-GFP (gift from Kathleen Green, addgene plasmid # 32227) and mCherry-TOMM20-N-10 (gift from Michael Davidson, addgene plasmid #55146) were used for transient transfections. Bacterial strains containing the constructs were grown in 200 mL Terrific Broth (A1374301, ThermoFisher Scientific) supplemented with 100 µg/mL carbenicillin (BP26481, ThermoFisher Scientific) or 100 µg/mL kanamycin (BP9065, ThermoFisher Scientific) overnight in a shaking incubator at 37°C. DNA plasmids were extracted from the bacterial cultures using an EndoFree Plasmid Maxi Kit (12362, QIAGEN) according to manufacturer’s instructions and resuspended in the provided endotoxin-free water. DNA concentrations were quantified using a NanoDrop8000 (ThermoFisher Scientific) and stored at -20°C. A working DNA stock for transfections was made by diluting the DNA to a final concentration of 0.25 µg/µL in Opti-MEM (31985070, ThermoFisher Scientific) and stored at -20°C. Three days after cells were plated, they were transfected using the GeneJuice® Transfection Reagent (70967, EMD Millipore). Media was replaced with phenol red-free mTeSR1 30-60 minutes prior to transfection. 1.5 μL GeneJuice transfection reagent was diluted in 25 μLOpti-MEM and incubated at room temperature for 5 min. 1 μg DNAwas added to the GeneJuice-Opti-MEM solution and incubated for 10 min. 6 μL of this final transfection solution was added per 100 μL media in the well of a 96 well-plate. Live cells were imaged as specified above one day after transfection.
The constructs pmEGFP-a-tubulin-C1 (gift from Daniel Gerlich, addgene plasmid # 21039), 1136-Desmoplakin-GFP (gift from Kathleen Green, addgene plasmid # 32227) and mCherry-TOMM20-N-10 (gift from Michael Davidson, addgene plasmid #55146) were used for transient transfections. Bacterial strains containing the constructs were grown in 200 mL Terrific Broth (A1374301, ThermoFisher Scientific) supplemented with 100 µg/mL carbenicillin (BP26481, ThermoFisher Scientific) or 100 µg/mL kanamycin (BP9065, ThermoFisher Scientific) overnight in a shaking incubator at 37°C. DNA plasmids were extracted from the bacterial cultures using an EndoFree Plasmid Maxi Kit (12362, QIAGEN) according to manufacturer’s instructions and resuspended in the provided endotoxin-free water. DNA concentrations were quantified using a NanoDrop8000 (ThermoFisher Scientific) and stored at -20°C. A working DNA stock for transfections was made by diluting the DNA to a final concentration of 0.25 µg/µL in Opti-MEM (31985070, ThermoFisher Scientific) and stored at -20°C. Three days after cells were plated, they were transfected using the GeneJuice® Transfection Reagent (70967, EMD Millipore). Media was replaced with phenol red-free mTeSR1 30-60 minutes prior to transfection. 1.5 μL GeneJuice transfection reagent was diluted in 25 μLOpti-MEM and incubated at room temperature for 5 min. 1 μg DNAwas added to the GeneJuice-Opti-MEM solution and incubated for 10 min. 6 μL of this final transfection solution was added per 100 μL media in the well of a 96 well-plate. Live cells were imaged as specified above one day after transfection.
Labeling cells with fluorescent dyes
Three to four days after cells are plated and mature and healthy colonies are observed on 96- and 24-well imaging plates, the cells are stained with NucBlue Live ready probe reagent (R37605, ThermoFisher) and CellMask Deep Red plasma membrane stain (C10046, ThermoFisher) to visualize DNA and plasma membrane, respectively. Phenol red free mTeSR1 is pre-equilibrated to 37°C and 5% CO2. 1X NucBlue solution made in pre-equilibrated phenol red-free mTeSR1 is spun for 60 min at 20,000 g. 2X and 10X working stocks of CellMask Deep Red lot #1730970 and #1813792 are made in 1X NucBlue solution, respectively. All solutions are kept at 37°C and 5% CO2 until used. 100 µL and 400 µL of NucBlue solution is added per well of 96-well imaging plates and 24-well imaging plates, respectively, and incubated at 37°C and 5% CO2 for 20 min. An equal amount of CellMask Deep Red working stock is added to the wells containing NucBlue solution. Final dye concentrations in the wells are 1X NucBlue and 1X and 5X CellMask Deep Red lots #1730970 and #1813792, respectively. Cells are incubated at 37°C and 5% CO2 for 10 min and gently washed with pre-equilibrated phenol red-free mTeSR1. Cells are imaged immediately following the wash step and for up to 2.5 hr on a Zeiss spinning disk microscope at 100x with the following general settings: 405 nm at 0.28 mW, 200 ms exposure; 638 nm at 2.4 mW, 200 ms exposure; acquiring each channel at each z-step.
Three to four days after cells are plated and mature and healthy colonies are observed on 96- and 24-well imaging plates, the cells are stained with NucBlue Live ready probe reagent (R37605, ThermoFisher) and CellMask Deep Red plasma membrane stain (C10046, ThermoFisher) to visualize DNA and plasma membrane, respectively. Phenol red free mTeSR1 is pre-equilibrated to 37°C and 5% CO2. 1X NucBlue solution made in pre-equilibrated phenol red-free mTeSR1 is spun for 60 min at 20,000 g. 2X and 10X working stocks of CellMask Deep Red lot #1730970 and #1813792 are made in 1X NucBlue solution, respectively. All solutions are kept at 37°C and 5% CO2 until used. 100 µL and 400 µL of NucBlue solution is added per well of 96-well imaging plates and 24-well imaging plates, respectively, and incubated at 37°C and 5% CO2 for 20 min. An equal amount of CellMask Deep Red working stock is added to the wells containing NucBlue solution. Final dye concentrations in the wells are 1X NucBlue and 1X and 5X CellMask Deep Red lots #1730970 and #1813792, respectively. Cells are incubated at 37°C and 5% CO2 for 10 min and gently washed with pre-equilibrated phenol red-free mTeSR1. Cells are imaged immediately following the wash step and for up to 2.5 hr on a Zeiss spinning disk microscope at 100x with the following general settings: 405 nm at 0.28 mW, 200 ms exposure; 638 nm at 2.4 mW, 200 ms exposure; acquiring each channel at each z-step.
In vitro directed differentiation of hiPSCs to cardiomyocytes
Cells are seeded onto GFR Matrigel-coated 6-well tissue culture plates at a density ranging from 0.15-0.25x106 cells per well in mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor, designated as day -3. Cells are grown for three days, with daily mTeSR1 media changes (day -2 and day -1). The following day (designated as day 0), directed cardiac differentiation is initiated by treating the cultures with 7.5 µM CHIR99021 (Cayman Chemical) in RPMI media (Gibco) containing insulin-free B27 supplement (Gibco). After 48 hours (day 2), cultures are treated with 7.5 µM IWP2 (R&D systems) in RPMI media containing insulin-free B27 supplement. On day 4, cultures are treated with RPMI media containing insulin-free B27 supplement. From day 6 onwards, media is replaced with RPMI media supplemented containing B27 containing insulin (Gibco) every 2-3 days.
Cells are harvested using TrypLE Select (10x, Gibco) diluted to 2x with Versene (Gibco), fixed with 4% PFA in DPBS for 10 minutes at room temperature, permeabilized with BD Perm/Wash™ buffer containing anti-Cardiac Troponin T AlexaFluor® 647 or equal mass of mIgG1, k AF647 isotype control (all BD Bioscience), washed, then re-suspended in 5% FBS in DPBS with DAPI (2µg/ml), acquired on a FACSAriaIII (BD Bioscience) Fusion and analyzed using FlowJo software V.10.2. (Treestar, Inc.) Nucleated particles are identified as a sharp, condensed peak on a DAPI histogram and are then gated to exclude doublets as described above. The cTnT+ gate is set to include 1% of cells in the isotype control sample.
Cells are seeded onto GFR Matrigel-coated 6-well tissue culture plates at a density ranging from 0.15-0.25x106 cells per well in mTeSR1 supplemented with 1% P/S and 10 µM ROCK inhibitor, designated as day -3. Cells are grown for three days, with daily mTeSR1 media changes (day -2 and day -1). The following day (designated as day 0), directed cardiac differentiation is initiated by treating the cultures with 7.5 µM CHIR99021 (Cayman Chemical) in RPMI media (Gibco) containing insulin-free B27 supplement (Gibco). After 48 hours (day 2), cultures are treated with 7.5 µM IWP2 (R&D systems) in RPMI media containing insulin-free B27 supplement. On day 4, cultures are treated with RPMI media containing insulin-free B27 supplement. From day 6 onwards, media is replaced with RPMI media supplemented containing B27 containing insulin (Gibco) every 2-3 days.
Cells are harvested using TrypLE Select (10x, Gibco) diluted to 2x with Versene (Gibco), fixed with 4% PFA in DPBS for 10 minutes at room temperature, permeabilized with BD Perm/Wash™ buffer containing anti-Cardiac Troponin T AlexaFluor® 647 or equal mass of mIgG1, k AF647 isotype control (all BD Bioscience), washed, then re-suspended in 5% FBS in DPBS with DAPI (2µg/ml), acquired on a FACSAriaIII (BD Bioscience) Fusion and analyzed using FlowJo software V.10.2. (Treestar, Inc.) Nucleated particles are identified as a sharp, condensed peak on a DAPI histogram and are then gated to exclude doublets as described above. The cTnT+ gate is set to include 1% of cells in the isotype control sample.